pCFD8
(Plasmid
#140619)
-
Purpose(Empty Backbone) Expression of one of several LbCas12a crRNAs in Drosophila
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCFD5w
-
Backbone manufacturerFillip Port and Michael Boutros
- Backbone size (bp) 7669
-
Modifications to backboneReplaced Cas9 sgRNa cassette with LbCas12a crRNA stem loop, a 2xBbsI restriction cassette, and a downstream tRNA.
-
Vector typeInsect Expression, CRISPR
- Promoter Drosophila U6:3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer ACGTTTTATAACTTATGCCCCTAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD8 was a gift from Michael Boutros (Addgene plasmid # 140619 ; http://n2t.net/addgene:140619 ; RRID:Addgene_140619) -
For your References section:
Multiplexed conditional genome editing with Cas12a in Drosophila. Port F, Starostecka M, Boutros M. Proc Natl Acad Sci U S A. 2020 Aug 25. pii: 2004655117. doi: 10.1073/pnas.2004655117. 10.1073/pnas.2004655117 PubMed 32843348
Map uploaded by the depositor.
