pCS2-CIB1-mCherry-Rab11
(Plasmid #140573)

• Purpose: For use in light-induced protein inactivation through the interaction with CRY2
• Depositing Lab: Heidi Hehnly
• Publication: Rathbun et al Nat Commun. 2020 Mar 9;11(1):1269. doi: 10.1038/s41467-020-15002-8.

Backbone

• Vector backbone: pCS2
• Backbone size w/o insert (bp): 4091
• Total vector size (bp): 5988
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: CIB1
• Alt name: cryptochrome-interacting basic-helix-loop-helix 1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1902
• Entrez Gene: CIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
• Promoter: CMV IE94
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: SP6

Gene/Insert 2

• Gene/Insert name: RAB11A, member RAS oncogene family
• Species: H. sapiens (human)
• Insert Size (bp): 648
• Entrez Gene: RAB11A (a.k.a. YL8)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcatggacgagctgtacaa
• 3′ sequencing primer: T3

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid 58366

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry