MKV937/nlp-1p::FlincG3
(Plasmid
#140508)
-
PurposeThis construct contains cGMP biosensor driven by nlp-1 promoter for expression in PHB sensory neuron in pSMdelta backbone.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140508 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSM
- Backbone size w/o insert (bp) 5799
- Total vector size (bp) 7566
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFlincG3
-
Insert Size (bp)1767
- Promoter nlp-1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGACATCAACTTGAGGCAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MKV937/nlp-1p::FlincG3 was a gift from Miri VanHoven (Addgene plasmid # 140508 ; http://n2t.net/addgene:140508 ; RRID:Addgene_140508) -
For your References section:
Using a Robust and Sensitive GFP-Based cGMP Sensor for Real Time Imaging in Intact Caenorhabditis elegans. Woldemariam S, Nagpal J, Hill T, Li J, Schneider MW, Shankar R, Futey M, Varshney A, Ali N, Mitchell J, Andersen K, Barsi-Rhyne B, Tran A, Costa WS, Krzyzanowski MC, Yu YV, Brueggemann C, Hamilton OS, Ferkey DM, VanHoven M, Sengupta P, Gottschalk A, L'Etoile N. Genetics. 2019 Jul 22. pii: genetics.119.302392. doi: 10.1534/genetics.119.302392. 10.1534/genetics.119.302392 PubMed 31331946
