pCMV R-CEPIA3mt
(Plasmid #140464)

• Purpose: Red fluorescent indicator for calcium imaging in the mitochondria (low affinity variant)
• Depositing Lab: Masamitsu Iino
• Publication: Kanemaru et al Sci Rep. 2020 Feb 18;10(1):2835. doi: 10.1038/s41598-020-59707-8.

Backbone

• Vector backbone: pCMV/myc/mito
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4799
• Total vector size (bp): 6404
• Modifications to backbone: Duplicate mitochondria targeting sequence.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: R-CEPIA3mt
• Species: Synthetic
• Insert Size (bp): 1608
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Supplemental Documents:
  • pCMV R-CEPIA3mt.txt
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry