-
PurposeRed fluorescent indicator for calcium imaging in the mitochondria (low affinity variant)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMV/myc/mito
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4799
- Total vector size (bp) 6404
-
Modifications to backboneDuplicate mitochondria targeting sequence.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameR-CEPIA4mt
-
SpeciesSynthetic
-
Insert Size (bp)1608
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV R-CEPIA4mt was a gift from Masamitsu Iino (Addgene plasmid # 140463 ; http://n2t.net/addgene:140463 ; RRID:Addgene_140463) -
For your References section:
Red fluorescent CEPIA indicators for visualization of Ca(2+) dynamics in mitochondria. Kanemaru K, Suzuki J, Taiko I, Iino M. Sci Rep. 2020 Feb 18;10(1):2835. doi: 10.1038/s41598-020-59707-8. 10.1038/s41598-020-59707-8 PubMed 32071363
Map uploaded by the depositor.
