Skip to main content
Addgene

pAc-­His-­zfKitlgb
(Plasmid #140293)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140293 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAcGP-67A
  • Backbone size w/o insert (bp) 9748
  • Total vector size (bp) 10472
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Kitlgb
  • Alt name
    Kit ligand b
  • Alt name
    SCFb
  • Alt name
    stem cell factor b
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    480
  • Entrez Gene
    kitlgb (a.k.a. kitlb)
  • Tag / Fusion Protein
    • 6x His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCGGATTATTCATACCGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a V117I mutation in the insert. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc-­His-­zfKitlgb was a gift from Petr Bartunek (Addgene plasmid # 140293 ; http://n2t.net/addgene:140293 ; RRID:Addgene_140293)
  • For your References section:

    Zebrafish Kit ligands cooperate with erythropoietin to promote erythroid cell expansion. Oltova J, Svoboda O, Machonova O, Svatonova P, Traver D, Kolar M, Bartunek P. Blood Adv. 2020 Dec 8;4(23):5915-5924. doi: 10.1182/bloodadvances.2020001700. 10.1182/bloodadvances.2020001700 PubMed 33259600