pAc-His-zfKitlga
(Plasmid
#140292)
-
PurposeExpress soluble His-tagged zebrafish Kitlga in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcGP-67A
- Backbone size w/o insert (bp) 9748
- Total vector size (bp) 10467
-
Modifications to backbone6xHis tag insert
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKitlga
-
Alt nameKit ligand a
-
Alt nameSCFa
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)486
-
Entrez Genekitlga (a.k.a. kitla)
-
Tag
/ Fusion Protein
- 6x His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCGGATTATTCATACCGTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc-His-zfKitlga was a gift from Petr Bartunek (Addgene plasmid # 140292 ; http://n2t.net/addgene:140292 ; RRID:Addgene_140292) -
For your References section:
Zebrafish Kit ligands cooperate with erythropoietin to promote erythroid cell expansion. Oltova J, Svoboda O, Machonova O, Svatonova P, Traver D, Kolar M, Bartunek P. Blood Adv. 2020 Dec 8;4(23):5915-5924. doi: 10.1182/bloodadvances.2020001700. 10.1182/bloodadvances.2020001700 PubMed 33259600