plet7d_stbC-EGFP
(Plasmid
#140266)
-
PurposeLIN28-dependent translational repression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140266 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStabilized hairpin of miR-let7d
-
Alt namelet7d_stbC
-
SpeciesSynthetic
-
Insert Size (bp)42
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer CTTTATTTGTAACCATTATAAGCTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
let7d_stbC motif was inserted between BamHI and AgeI sites of pAptamerCassette-EGFP (ID: 140288).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plet7d_stbC-EGFP was a gift from Hirohide Saito (Addgene plasmid # 140266 ; http://n2t.net/addgene:140266 ; RRID:Addgene_140266) -
For your References section:
Synthetic mRNA devices that detect endogenous proteins and distinguish mammalian cells. Kawasaki S, Fujita Y, Nagaike T, Tomita K, Saito H. Nucleic Acids Res. 2017 May 19. doi: 10.1093/nar/gkx298. 10.1093/nar/gkx298 PubMed 28525643