Skip to main content
Addgene

CGBE1-VRQR (pBM1192)
(Plasmid #140254)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140254 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    CMV
  • Backbone manufacturer
    pCMV-ABEmax-P2A-EGFP (Addgene #112101)
  • Backbone size w/o insert (bp) 3400
  • Total vector size (bp) 9909
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eUNG-BE4max(R33A)_VRQR-ΔUGI
  • Alt name
    bpNLS-UNG(E.coli)-rAPOBEC1(R33A)-nCas9_VRQR-bpNLS-P2A-EGFP
  • Species
    R. norvegicus (rat); E. coli, S. pyogenes
  • Insert Size (bp)
    6544
  • Mutation
    R33A in rAPOBEC1, VRQR mutations in SpCas9, D10A in Cas9
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #140251, SpCas9_VRQR from the Kleinstiver Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CGBE1-VRQR (pBM1192) was a gift from Keith Joung (Addgene plasmid # 140254 ; http://n2t.net/addgene:140254 ; RRID:Addgene_140254)

  • For your References section:

    CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald J, Joung JK. Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x. 10.1038/s41587-020-0609-x PubMed 32690971
Related items:
Commonly requested with: