SPACE-NG (pRZ5150)
(Plasmid #140244)

• Purpose: CMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFP
• Depositing Lab: Keith Joung
• Publication: Grunewald et al Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0535-y. doi: 10.1038/s41587-020-0535-y.

Backbone

• Vector backbone: CMV
• Backbone manufacturer: pCMV-ABEmax-P2A-EGFP (Addgene #112101)
• Backbone size w/o insert (bp): 3400
• Total vector size (bp): 10308
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SPACE_NG
• Alt name: bpNLS-TadA*(V82G)-nCas9_NG-bpNLS-pmCDA1(R187W)-UGI-UGI-P2A-EGFP
• Species: E. coli, S. pyogenes, P. marinus
• Insert Size (bp): 6943
• Mutation: V82G in TadA*, NG mutations in SpCas9, D10A in SpCas9_NG, R187W in pmCDA1
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pRZ5150 Sanger Sequencing.gb
  • pRZ5150 map
• A portion of this plasmid was derived from a plasmid made by: Addgene #131313, #131300, #125615
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry