Skip to main content
Addgene

SPACE (pRZ1813)
(Plasmid #140242)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140242 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CMV
  • Backbone manufacturer
    pCMV-ABEmax-P2A-EGFP (Addgene #112101)
  • Backbone size w/o insert (bp) 3400
  • Total vector size (bp) 10308
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SPACE
  • Alt name
    bpNLS-TadA*(V82G)-nCas9-bpNLS-pmCDA1(R187W)-UGI-UGI-P2A-EGFP
  • Species
    E. coli, S. pyogenes, P. marinus
  • Insert Size (bp)
    6943
  • Mutation
    V82G in TadA*, D10A in Cas9, R187W in pmCDA1
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene #131313, #131300

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SPACE (pRZ1813) was a gift from Keith Joung (Addgene plasmid # 140242 ; http://n2t.net/addgene:140242 ; RRID:Addgene_140242)
  • For your References section:

    A dual-deaminase CRISPR base editor enables concurrent adenine and cytosine editing. Grunewald J, Zhou R, Lareau CA, Garcia SP, Iyer S, Miller BR, Langner LM, Hsu JY, Aryee MJ, Joung JK. Nat Biotechnol. 2020 Jun 1. pii: 10.1038/s41587-020-0535-y. doi: 10.1038/s41587-020-0535-y. 10.1038/s41587-020-0535-y PubMed 32483364