Skip to main content
Addgene

pLVX-BSD-tet-mEGFP-MIB1
(Plasmid #140241)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140241 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLVX-BSD-tet
  • Backbone size w/o insert (bp) 8011
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet-inducible mEGFP-MIB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3821
  • Entrez Gene
    MIB1 (a.k.a. DIP-1, DIP1, LVNC7, MIB, ZZANK2, ZZZ6)
  • Promoter TRE
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TATGTCGAGGTAGGCGTGTA
  • 3′ sequencing primer ctctaggcaccggatcaatt
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-BSD-tet-mEGFP-MIB1 was a gift from Urs Greber (Addgene plasmid # 140241 ; http://n2t.net/addgene:140241 ; RRID:Addgene_140241)

  • For your References section:

    The E3 Ubiquitin Ligase Mind Bomb 1 Controls Adenovirus Genome Release at the Nuclear Pore Complex. Bauer M, Flatt JW, Seiler D, Cardel B, Emmenlauer M, Boucke K, Suomalainen M, Hemmi S, Greber UF. Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064. 10.1016/j.celrep.2019.11.064 PubMed 31851912
Related items:
Commonly requested with: