Lenti-eCas9
(Plasmid #140237)

• Purpose: (Empty Backbone) Lentiviral vector for expression of high-specificity eSpCas9(1.1) and sgRNA scaffold
• Depositing Lab: Urs Greber
• Publication: Bauer et al Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064.

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Feng Zhang lab
• Backbone size (bp): 10017
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced specificity Cas9 (1.1)
• Alt name: eSpCas9(1.1)
• Species: Synthetic
• Insert Size (bp): 4945
• Promoter: EF-1a core
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gggggagaaccgtatataag
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • Lenti-eCas9.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry