Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TP2_crtYB
(Plasmid #140233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    TPS2
  • Total vector size (bp) 6224
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phytoene-beta carotene synthase
  • Alt name
    crtYB
  • Insert Size (bp)
    2016
  • Mutation
    na
  • GenBank ID
    AII26676.1
  • Promoter t7 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggatctcgacgctctccctt
  • 3′ sequencing primer CCcaagtgtgagtcgagggAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The minor differences between the sequence and .gb file are of no functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TP2_crtYB was a gift from Kang Zhou (Addgene plasmid # 140233 ; http://n2t.net/addgene:140233 ; RRID:Addgene_140233)