pSLQ8636 PB-PGK-RR12EE345L-C term (406) dLbCpf1-N intein-pA
(Plasmid
#140223)
-
PurposeConstitutive PGK driven expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to intein for 3-way split activator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namezipper with dLbCpf1 (Cas12a) C terminal half (406) fused to N-intein
-
SpeciesSynthetic
-
MutationD832A
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATTCTGCACGCTTCAAAAGC
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ8636 PB-PGK-RR12EE345L-C term (406) dLbCpf1-N intein-pA was a gift from Stanley Qi (Addgene plasmid # 140223 ; http://n2t.net/addgene:140223 ; RRID:Addgene_140223) -
For your References section:
Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839