pSLQ8518 PB-PGK-N term (1-406) dLbCpf1-EE12RR345L-pA
(Plasmid
#140221)
-
PurposeConstitutive PGK driven expression of N terminal dCpf1 (Cas12a) 406-split half with leucine zipper
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonePB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLbCpf1 (Cas12a) N terminal half (406) with zipper
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATTCTGCACGCTTCAAAAGC
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ8518 PB-PGK-N term (1-406) dLbCpf1-EE12RR345L-pA was a gift from Stanley Qi (Addgene plasmid # 140221 ; http://n2t.net/addgene:140221 ; RRID:Addgene_140221) -
For your References section:
Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839
