pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
(Plasmid #140205)

• Purpose: Proof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pKW20088
• Backbone manufacturer: doi:10.1038/nchembio.1366
• Backbone size w/o insert (bp): 14245
• Total vector size (bp): 15879
• Vector type: CRISPR, Synthetic Biology ; Proof-of-concept test target of a in filamentous fungi.
• Selectable markers: URA3 ; Af pyrG

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Insert Size (bp): 709
• Mutation: G174D
• Promoter: PelcA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACTGAGAACCATGGCACCGAAG

Gene/Insert 2

• Gene/Insert name: sgRNA E1
• Insert Size (bp): 96
• Promoter: U3

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmbI (destroyed during cloning)
• 3′ cloning site: BsmbI (destroyed during cloning)
• 5′ sequencing primer: ACAGAACAAACCGAGCAAACATG
• 3′ sequencing primer: GCCAGTCACGATACATCCATGA

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To be cotransformed in strains expressing dSpCas9-VPR. This proof-of-concept vector is intended to serve as a positive control and aid the implementation of the CRISPRa vector set in other fungal species, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy when Cas9 is expressed from pCRI006. The mCherry mutation G174D does not appear to affect fluorescence.