pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
(Plasmid #140203)

• Purpose: Fungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: New backbone modified from pYFAC-pyroA
• Backbone manufacturer: DOI: 10.1039/C8SC02870B
• Backbone size w/o insert (bp): 14581
• Total vector size (bp): 15789
• Vector type: CRISPR, Synthetic Biology
• Selectable markers: URA3 ; Af pyroA

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: crRNA array elcA
• gRNA/shRNA sequence: ATTCCACTCATCATAGTACT, GATGGTGGTGCTAGCTTCTC , CTCAACACTGTACTGGCAAC, AACATCCTTGTGTGAATATT
• Species: Parastagonospora nodorum elcA spacers, Lachnospiraceae bacterium Cas12a crRNA scaffold
• Promoter: PgpdA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmbI (destroyed during cloning)
• 3′ cloning site: BsmbI (destroyed during cloning)
• 5′ sequencing primer: GTCAGTCCAACATTTGTTGC

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To be contransformed with pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI in strains expressing dLbCas12a-VPR or dLbCas12a(D156R). These proof-of-concept vectors are intended to work as a positive control and aid the implementation of the CRISPRa vector set, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy.