pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
(Plasmid #140201)

• Purpose: (Empty Backbone) Fungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: New backbone modified from pYFAC-pyroA
• Backbone manufacturer: DOI: 10.1039/C8SC02870B
• Backbone size (bp): 11339
• Modifications to backbone: The parts of pYFAC for replication in Saccharomyces cerevisiae were eliminated to avoid BsmbI sites and pyroA marker terminator region was BsmbI domesticated.
• Vector type: CRISPR, Synthetic Biology ; Cloning of crRNA and expression in Aspergillus nidulans and related filamentous fungi.
• Promoter: PgpdA
• Selectable markers: Af pyroA
• Tags / Fusion Proteins:
  • dLbCas12a crRNA scaffold (N terminal on insert)
  • dLbCas12a crRNA scaffold (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GTCAGTCCAACATTTGTTGC

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning of crRNA arrays is done with BsmbI digestion of the vector and ligation of annealed oligonucleotides containing the crRNA sequences, making use of the two crRNA scaffolds in the vector to start and finish the array. Electroporation is recommended for higher efficiency in cloning.