pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
(Plasmid #140200)

• Purpose: (Empty Backbone) Cloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pGemT
• Backbone manufacturer: Promega
• Backbone size (bp): 3003
• Vector type: CRISPR, Synthetic Biology
• Promoter: PgpdA
• Tags / Fusion Proteins:
  • dLbCas12a crRNA scaffold (N terminal on insert)
  • dLbCas12a crRNA scaffold (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GTCAGTCCAACATTTGTTGC

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

First step of the 2-vector crRNA array cloning alternative. Cloning of crRNA arrays is done with BsmbI digestion of the vector and ligation of annealed oligonucleotides containing the crRNA sequences, making use of the two crRNA scaffolds in the vector to start and finish the array. Screening can be performed with EcoRI digestion. The expression cassette is further PCR amplified with primers that contain the 10 bp missing in the 5' of this vector Pgpda. This amplicon is then cloned in a fungal vector.