pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
(Plasmid #140199)

• Purpose: Episomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pYFAC-riboB
• Backbone manufacturer: DOI: 10.1039/C8SC02870B
• Backbone size w/o insert (bp): 14777
• Total vector size (bp): 25390
• Vector type: CRISPR, Synthetic Biology ; Expression in Aspergillus nidulans and related filamentous fungi.
• Selectable markers: URA3 ; Af riboB

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dSpCas9-VPR
• Alt name: dCas9-VPR
• Species: Synthetic; Streptococcus pyogenes
• Insert Size (bp): 5349
• Promoter: PgpdA
• Tag / Fusion Protein:
  • VPR (VP64-p65-Rta), NLS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCAGTCCAACATTTGTTGC

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry