pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
(Plasmid
#140196)
-
PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGem
- Backbone size w/o insert (bp) 3033
- Total vector size (bp) 12892
-
Vector typeCRISPR, Synthetic Biology ; Fungal genome integration.
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedSpCas9-VPR
-
Alt namedCas9-VPR
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)5730
- Promoter PgpdA
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta) , NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCAGTCCAACATTTGTTGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBar
-
Alt nameGlufosinate/basta-resistance
-
SpeciesStreptomyces hygroscopicus
-
Insert Size (bp)552
- Promoter PtrpC
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGACAGAAGATGATATTGAAGGAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameHomology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1040
Gene/Insert 4
-
Gene/Insert nameHomology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1033
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be linerised with NotI for homologous recombination in Aspergillus nidulans nkuA deficient strains, selecting with glufosinate/Basta. It can also be used for random genome integration in other fungal strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS was a gift from Yit Heng Chooi (Addgene plasmid # 140196 ; http://n2t.net/addgene:140196 ; RRID:Addgene_140196) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136