Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKM493
(Plasmid #140191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140191 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKM488
  • Backbone manufacturer
    Kenan Murphy
  • Backbone size w/o insert (bp) 3486
  • Total vector size (bp) 4247
  • Modifications to backbone
    Insertion of TEV-Flag-Gly4-eGFP
  • Vector type
    Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TEV-Flag-Gly4-eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    793
  • Promoter PGroEL
  • Tag / Fusion Protein
    • Flag + eGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GAGGAACTGGCGCAGTTCCTCTGG
  • 3′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pKM493 is an ORBIT integrating vector used to tag C-terminus of chromosomal genes with Flag-GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM493 was a gift from Kenan Murphy (Addgene plasmid # 140191 ; http://n2t.net/addgene:140191 ; RRID:Addgene_140191)
  • For your References section:

    ORBIT: a New Paradigm for Genetic Engineering of Mycobacterial Chromosomes. Murphy KC, Nelson SJ, Nambi S, Papavinasasundaram K, Baer CE, Sassetti CM. MBio. 2018 Dec 11;9(6). pii: mBio.01467-18. doi: 10.1128/mBio.01467-18. 10.1128/mBio.01467-18 PubMed 30538179