Skip to main content
Addgene

pEU3-NII-GLICNot-C-BIOT
(Plasmid #140186)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140186 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEU3-NII-GLICNot-C-BIOT
  • Backbone size (bp) 4483
  • Vector type
    expression vector for a cell-free system
  • Promoter T7
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • Biotinylation (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTATAGGGTACACGGAATTCGC
  • 3′ sequencing primer TATAGGAAGGCCGGATAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEU3-NII-GLICNot-C-BIOT was a gift from Tamás Mészáros (Addgene plasmid # 140186 ; http://n2t.net/addgene:140186 ; RRID:Addgene_140186)
  • For your References section:

    A novel family of expression vectors with multiple affinity tags for wheat germ cell-free protein expression. Nagy SK, Kallai BM, Andras J, Meszaros T. BMC Biotechnol. 2020 Mar 14;20(1):17. doi: 10.1186/s12896-020-00610-5. 10.1186/s12896-020-00610-5 PubMed 32169064