pCEFL GAL4dbd-KLF4 1-156
(Plasmid #140147)

• Purpose: GAL4-DNA binding domain fusion protein with the 156 N-terminal amino acids of human KLF4 (activation domain)
• Depositing Lab: Ramiro Iglesias-Bartolome
• Publication: Yuan et al Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0.

Backbone

• Vector backbone: pCEFL
• Total vector size (bp): 6967
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KLF4 aa 1-156
• Species: H. sapiens (human)
• Mutation: Deleted amino acids 157 to 479
• GenBank ID: NM_004235
• Entrez Gene: KLF4 (a.k.a. EZF, GKLF)
• Promoter: EF1a
• Tag / Fusion Protein:
  • GAL4dbd (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TTCTTCCATTTCAGGTGTCG
• 3′ sequencing primer: ATT TAG GTG ACA CTA TAG

Resource Information

• Supplemental Documents:
  • pCEFL GAL4dbd-KLF4 1-156.txt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry