pCEFL EGFP-TEADi
(Plasmid #140144)

• Purpose: TEAD inhibitor (TEADi): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal.
• Depositing Lab: Ramiro Iglesias-Bartolome
• Publication: Yuan et al Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0.

Backbone

• Vector backbone: pCEFL
• Total vector size (bp): 6803
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP TEADi
• Alt name: Green fluorescent tagged TEAD inhibitor
• Species: H. sapiens (human)
• Insert Size (bp): 1077
• Promoter: EF1a
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TTCTTCCATTTCAGGTGTCG
• 3′ sequencing primer: ATT TAG GTG ACA CTA TAG

Resource Information

• Supplemental Documents:
  • pCEFL EGFP-TEADi.gb.txt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We have observed that in certain cancer cell lines TEADi gets degraded or is expressed at low levels, resulting in incomplete TEAD inhibition. We recommend checking by Western Blot with anti-GFP antibody that the correct molecular weight of the full construct is expressed (approximately 39kDa) and check that known targets of TEAD are downregulated upon expression of TEADi. As with other dominant negative proteins, good levels of expression are necessary for TEADi to block TEADs.