Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHIs8-4b-SaDAH::G226D
(Plasmid #140130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140130 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHis8-4b
  • Backbone size w/o insert (bp) 5276
  • Total vector size (bp) 6332
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dechloroacutumine halogenase G226D variant from Sinomenium acutum
  • Alt name
    SaDAH::G226D
  • Species
    Sinomenium acutum
  • Insert Size (bp)
    1056
  • Mutation
    changed Gly226 to Asp226
  • GenBank ID
    MT040708
  • Promoter T7
  • Tag / Fusion Protein
    • 8x-His, TEV protease site (ENLYFQ) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expressed robustly in E.coli. Catalyzes hydroxylation of dechloroacutumine in vitro

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHIs8-4b-SaDAH::G226D was a gift from Jing-Ke Weng (Addgene plasmid # 140130 ; http://n2t.net/addgene:140130 ; RRID:Addgene_140130)
  • For your References section:

    The chloroalkaloid (-)-acutumine is biosynthesized via a Fe(II)- and 2-oxoglutarate-dependent halogenase in Menispermaceae plants. Kim CY, Mitchell AJ, Glinkerman CM, Li FS, Pluskal T, Weng JK. Nat Commun. 2020 Apr 20;11(1):1867. doi: 10.1038/s41467-020-15777-w. 10.1038/s41467-020-15777-w PubMed 32313070