Skip to main content
Addgene

pSLQ8454 pHR-hU6-LbCpf1 crRNA BB-EF1a-Puro-WPRE
(Plasmid #140087)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140087 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCpf1 (LbCas12a) crRNA backbone
  • Species
    Synthetic
  • Promoter U6
  • Tag / Fusion Protein
    • EF1a-Puro (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgggtttattacagggacagcagag
  • 3′ sequencing primer gagccagtacacgacatcactttc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ8454 pHR-hU6-LbCpf1 crRNA BB-EF1a-Puro-WPRE was a gift from Stanley Qi (Addgene plasmid # 140087 ; http://n2t.net/addgene:140087 ; RRID:Addgene_140087)

  • For your References section:

    Multiple Input Sensing and Signal Integration Using a Split Cas12a System. Kempton HR, Goudy LE, Love KS, Qi LS. Mol Cell. 2020 Jan 30. pii: S1097-2765(20)30037-X. doi: 10.1016/j.molcel.2020.01.016. 10.1016/j.molcel.2020.01.016 PubMed 32027839
Related items: