Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZJQIBEBT003
(Plasmid #140053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET21c
  • Total vector size (bp) 9170
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eMutS-L157C-G233C-CBM-EGFP
  • Species
    Escherichia coli
  • Insert Size (bp)
    3783
  • Mutation
    L157C, G233C
  • Promoter T7
  • Tag / Fusion Protein
    • His-Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer eMutS-F:ATGAGTGCAATAGAAAATTTCG
  • 3′ sequencing primer eMutS-R:CACCAGGCTCTTCAAGCGATAAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZJQIBEBT003 was a gift from Jia Zhang (Addgene plasmid # 140053 ; http://n2t.net/addgene:140053 ; RRID:Addgene_140053)
  • For your References section:

    Efficient and Low-Cost Error Removal in DNA Synthesis by a High-Durability MutS. Zhang J, Wang Y, Chai B, Wang J, Li L, Liu M, Zhao G, Yao L, Gao X, Yin Y, Xu J. ACS Synth Biol. 2020 Apr 17;9(4):940-952. doi: 10.1021/acssynbio.0c00079. Epub 2020 Mar 13. 10.1021/acssynbio.0c00079 PubMed 32135061