pmCherry-2xFYVE
(Plasmid #140050)

• Purpose: Expresses mCherry-tagged HRS 2xFYVE in mammalian cells
• Depositing Lab: Harald Stenmark
• Publication: Sneeggen et al Nat Commun. 2019 Jun 28;10(1):2850. doi: 10.1038/s41467-019-10794-w.

Backbone

• Vector backbone: pmCherry-C3
• Backbone manufacturer: Clontech / in-house cloning
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5210
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tandem HRS FYVE domain
• Alt name: HGS
• Species: M. musculus (mouse)
• Mutation: two FYVE domains (amino acids 147-223), linked by QGQGS linker
• GenBank ID: 15239
• Entrez Gene: Hgs (a.k.a. Hgr, Hrs, ZFYVE8, tn)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI in backbone/MfeI in insert (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• Supplemental Documents:
  • pmCherry-2xFYVE.gb
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry