pSW036
(Plasmid
#140034)
-
PurposeKO of PCC 11901 acsA gene/expresses YFP under control of the cpt promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 5144
-
Modifications to backboneUp and downstream homology regions for recombination into the acsA locus in PCC 11901; cpt promoter
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYellow fluorescent protein
-
Alt nameYFP
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)801
-
GenBank IDJX472996.1
- Promoter cpt
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggtcatatccgaggcgtacattca
- 3′ sequencing primer T7 terminator (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBryan Pfleger
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/684944v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSW036 was a gift from Peter Nixon (Addgene plasmid # 140034 ; http://n2t.net/addgene:140034 ; RRID:Addgene_140034) -
For your References section:
Newly discovered Synechococcus sp. PCC 11901 is a robust cyanobacterial strain for high biomass production. Wlodarczyk A, Selao TT, Norling B, Nixon PJ. Commun Biol. 2020 May 7;3(1):215. doi: 10.1038/s42003-020-0910-8. 10.1038/s42003-020-0910-8 PubMed 32382027