pCAG/GFP
(Plasmid
#139980)
-
Purposeexpresses GFP under the promoter of CAG. Transgene flanked by AAV2 ITR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV2/9.cTnT.PI.EGFP.RBG
-
Backbone manufacturerPenn Vector Core
- Backbone size w/o insert (bp) 4405
- Total vector size (bp) 5124
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Insert Size (bp)717
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NHEI (not destroyed)
- 3′ cloning site NOTI (not destroyed)
- 5′ sequencing primer GTTAAAGCAAGCAGGAGACGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG/GFP was a gift from William Pu (Addgene plasmid # 139980 ; http://n2t.net/addgene:139980 ; RRID:Addgene_139980) -
For your References section:
AAV Gene Therapy Prevents and Reverses Heart Failure in A Murine Knockout Model of Barth Syndrome. Wang S, Li Y, Xu Y, Ma Q, Lin Z, Schlame M, Bezzerides VJ, Strathdee D, Pu WT. Circ Res. 2020 Mar 9. doi: 10.1161/CIRCRESAHA.119.315956. 10.1161/CIRCRESAHA.119.315956 PubMed 32146862