pET30a-His6-ABP-LOXCAT
(Plasmid #139971)

• Purpose: Fusion of A. viridans lactate oxidase (LOX) and E. coli catalase (CAT) that converts lactate into pyruvate without producing H2O2. Contains a albumin binding peptide (ABP).
• Depositing Lab: Vamsi Mootha
• Publication: Patgiri et al Nat Biotechnol. 2020 Jan 13. pii: 10.1038/s41587-019-0377-7. doi: 10.1038/s41587-019-0377-7.

Backbone

• Vector backbone: pET30a
• Backbone size w/o insert (bp): 8880
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: A fusion of lactate oxidase from A. viridans and catalase from E. coli
• Alt name: His6-ABP-LOXCAT
• Species: Lactate oxidase from A. viridans and Catalase from E. coli
• Insert Size (bp): 3639
• Promoter: T7
• Tag / Fusion Protein:
  • His6 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TTGTGAGCGGATAACAATTCCCC
• 3′ sequencing primer: AAGGGGTTATGCTAGTTATTGCTCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthesized by Genscript Biotech

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry