Skip to main content
Addgene

pFUW-tetO-HOXB4
(Plasmid #139829)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUW-tetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HOXB4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    756
  • Mutation
    R249P- Please see depositor comment below
  • GenBank ID
    NM_024014.4
  • Entrez Gene
    HOXA6 (a.k.a. HOX1, HOX1B, HOX1.2)
  • Promoter TRE-mCMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms point mutation in HOXB4 will not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-tetO-HOXB4 was a gift from Filipe Pereira (Addgene plasmid # 139829 ; http://n2t.net/addgene:139829 ; RRID:Addgene_139829)
  • For your References section:

    Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Ferreira AG, Gomes AM, Palma LG, Shaiv K, Solanas L, Azenha C, Papatsenko D, Schulz O, Reis e Sousa C, Pereira CF. Sci Immunol. 2018 Dec 7;3(30). pii: 3/30/eaau4292. doi: 10.1126/sciimmunol.aau4292. 10.1126/sciimmunol.aau4292 PubMed 30530727