Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUW-tetO-RUNX1
(Plasmid #139821)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139821 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUW-tetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Runx1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1362
  • GenBank ID
    NM_001754.4
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
  • Promoter TRE-mCMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-tetO-RUNX1 was a gift from Filipe Pereira (Addgene plasmid # 139821 ; http://n2t.net/addgene:139821 ; RRID:Addgene_139821)
  • For your References section:

    Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Ferreira AG, Gomes AM, Palma LG, Shaiv K, Solanas L, Azenha C, Papatsenko D, Schulz O, Reis e Sousa C, Pereira CF. Sci Immunol. 2018 Dec 7;3(30). pii: 3/30/eaau4292. doi: 10.1126/sciimmunol.aau4292. 10.1126/sciimmunol.aau4292 PubMed 30530727