pAC8_MF-PH-c-Myc-Cter (VE5632)
(Plasmid
#139778)
-
PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter C-Myc tag under the pH promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAcPAK8
-
Backbone manufacturerClontech
- Total vector size (bp) 6913
-
Modifications to backboneThe pAC8_MF-PH-c-myc-Cter (VE 5632) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains the Multibac dual expression cassette composed of two divergent baculovirus late promoters (PH and p10), each followed by a multiple cloning site (MSC1 and MSC2) and a transcription termination signal (SV40 pA and HSV-TK pA). It also possess a multiplication module (NruI, SpeI, BstZ17I restriction sites) for the insertion of additional expression cassettes and a loxP site for Cre-mediated fusion with a donor plasmid containing additional cassettes. This vector bears a c-Myc sequence allowing the expression of a C-terminally-tagged protein under the control of the PH promoter. Insertion of DNA sequence is typically performed in the two multiple cloning sites (MCS1 with BamHI/XbaI under the PH promoter and MCS2 with XhoI/NheI under the p10 promoter) by restriction/ligation or homology based cloning (SLIC, Infusion or Gibson). Dual expression cassettes can also be assembled directly using a 4 fragment reaction where the plasmid backbone is combined with the promoter module and the cDNAs encoding the two target genes.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-terminal C-Myc tag
- Promoter PH
-
Tag
/ Fusion Protein
- c-Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ACCATCTCGCAAATAAATAA
- 3′ sequencing primer TGGTATGGCTGATTATGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC8_MF-PH-c-Myc-Cter (VE5632) was a gift from Arnaud Poterszman (Addgene plasmid # 139778 ; http://n2t.net/addgene:139778 ; RRID:Addgene_139778) -
For your References section:
HR-Bac, a toolbox based on homologous recombination for expression, screening and production of multiprotein complexes using the baculovirus expression system. Kolesnikova O, Zachayus A, Pichard S, Osz J, Rochel N, Rossolillo P, Kolb-Cheynel I, Troffer-Charlier N, Compe E, Bensaude O, Berger I, Poterszman A. Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5. 10.1038/s41598-021-04715-5 PubMed 35132103