pAC8_MF-PH-Flag-Nter (VE5627)
(Plasmid #139773)

• Purpose: Transfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an N-ter Flag tag under the pH promoter.
• Depositing Lab: Arnaud Poterszman
• Publication: Kolesnikova et al Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5.

Backbone

• Vector backbone: pBAcPAK8
• Backbone manufacturer: Clontech
• Total vector size (bp): 6562
• Modifications to backbone: The pAC8_MF-PH-Flag-Nter (VE5627) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains the Multibac dual expression cassette composed of two divergent baculovirus late promoters (PH and p10), each followed by a multiple cloning site (MSC1 and MSC2) and a transcription termination signal (SV40 pA and HSV-TK pA). It also possess a multiplication module (NruI, SpeI, BstZ17I restriction sites) for the insertion of additional expression cassettes and a loxP site for Cre-mediated fusion with a donor plasmid containing additional cassettes. This vector bears a Flag sequence allowing the expression of a N-terminally-tagged protein under the control of the PH promoter. Insertion of DNA sequence is typically performed in the two multiple cloning sites (MCS1 with BamHI/XbaI under the PH promoter and MCS2 with XhoI/NheI under the p10 promoter) by restriction/ligation or homology based cloning (SLIC, Infusion or Gibson). Dual expression cassettes can also be assembled directly using a 4 fragment reaction where the plasmid backbone is combined with the promoter module and the cDNAs encoding the two target genes.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-terminal Flag tag
• Promoter: PH
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ACCATCTCGCAAATAAATAA
• 3′ sequencing primer: TGGTATGGCTGATTATGATC

Resource Information

• Supplemental Documents:
  • pAC8_MF-PH-Flag-Nter (VE5627).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry