pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621)
(Plasmid #139770)

• Purpose: Transfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter TwinStrep tag under the PH promoter.
• Depositing Lab: Arnaud Poterszman
• Publication: Kolesnikova et al Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5.

Backbone

• Vector backbone: pBAcPAK8
• Backbone manufacturer: Clontech
• Total vector size (bp): 7691
• Modifications to backbone: The pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains the Multibac dual expression cassette composed of two divergent baculovirus late promoters (PH and p10), each followed by a multiple cloning site (MSC1 and MSC2) and a transcription termination signal (SV40 pA and HSV-TK pA). It also possess a multiplication module (NruI, SpeI, BstZ17I restriction sites) for the insertion of additional expression cassettes and a loxP site for Cre-mediated fusion with a donor plasmid containing additional cassettes. This vector bears a 3C-TwinStrep sequence allowing the expression of a C-terminally-tagged protein under the control of the PH promoter. The mCherry reporter protein expressed under the control of the p10 promoter allows to monitor infection.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C-terminal TwinStrep tag
• Insert Size (bp): 7691
• Promoter: PH
• Tag / Fusion Protein:
  • 3C - TwinStrep tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ACCATCTCGCAAATAAATAA
• 3′ sequencing primer: TGGTATGGCTGATTATGATC

Resource Information

• Supplemental Documents:
  • pAC8_MF-P10-mCherry-pH-3C-TwinStrep (VE5621)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry