pAC8_MF-p10-mCh PH-mCh (VE5625)
(Plasmid #139769)

• Purpose: Transfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.
• Depositing Lab: Arnaud Poterszman
• Publication: Kolesnikova et al Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5.

Backbone

• Vector backbone: pBAcPAK8
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7175
• Total vector size (bp): 7887
• Modifications to backbone: The pAC8_MF-p10-mCh PH-mCh (VE5625) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains the Multibac dual expression cassette composed of two divergent baculovirus late promoters (PH and p10), each followed by a multiple cloning site (MSC1 and MSC2) and a transcription termination signal (SV40 pA and HSCV pA). It also possess a multiplication module for insertion of additional expression cassettes and a loxP site for Cre-mediated fusion with a donor plasmid containing additional expression cassettes. An mCherry gene is cloned in each MCS: One has to be replaced by the GOI; The protein expressed from the remaining mCherry gene will be used to monitor infection. Insertion of DNA sequence is typically performed in the two multiple cloning sites (MCS1 with BamHI/XbaI under the PH promoter and MCS2 with XhoI/NheI under the p10 promoter) by restriction/ligation or homology based cloning (SLIC, Infusion or Gibson). Dual expression cassettes can also be assembled directly using a 4 fragment reaction where the plasmid backbone is combined with the promoter module and the cDNAs encoding the two target genes.
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry fluorescent protein
• Insert Size (bp): 711
• Promoter: PH or p10

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI or XhoI (unknown if destroyed)
• 3′ cloning site: XbaI or NheI (unknown if destroyed)
• 5′ sequencing primer: ACCATCTCGCAAATAAATAA or CCCAACACAATATATTATAG
• 3′ sequencing primer: TGGTATGGCTGATTATGATC or CACCCGTGCGTTTTATTCTGTC

Resource Information

• Supplemental Documents:
  • pAC8_MF-p10-mCh PH-mCh (VE5625).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry