pLX_lenti_osTir1_9Myc_P2A_Bsd
(Plasmid #139746)

• Purpose: lentiviral vector expressing rice E3 ligase Tir1 in mammalian cells with selection marker
• Depositing Lab: Robert Tjian
• Publication: Xie et al Nat Methods. 2020 Apr;17(4):430-436. doi: 10.1038/s41592-020-0775-2. Epub 2020 Mar 16.

Backbone

• Vector backbone: lentiviral vector
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Screen 2-3 colonies to confirm isolation of the complete plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rice E3 ligase Tir1 (osTir1)
• Promoter: EF1alpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: tgatccggtgcctagagaaggtg

Resource Information

• Supplemental Documents:
  • pLX_lenti_osTir1_9Myc_P2A_Bsd.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene NGS identified only 6 of the 9 Myc repeats.

Plasmid is somewhat unstable and prone to recombination at the LTR sites. Pick at least 2-3 colonies for screening to confirm isolation of the intact plasmid. Smaller colonies are more likely to contain the complete plasmid.