pAAV ORANGE Gria1-HaloTag KI
(Plasmid #139655)

• Purpose: Endogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)
• Depositing Lab: Harold MacGillavry
• Publication: Willems et al PLoS Biol. 2020 Apr 10;18(4):e3000665. doi: 10.1371/journal.pbio.3000665.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 7363
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA and HaloTag donor
• gRNA/shRNA sequence: GGGAGCCACAGGATTGTAAC
• Species: M. musculus (mouse), R. norvegicus (rat)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)

Resource Information

• Supplemental Documents:
  • pAAV ORANGE Gria1-HaloTag KI.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note Addgene NGS found some discrepancies in the ITR regions of these plasmids. These regions are repetitive and can be difficult to sequence using NGS. Depositor confirms plasmids are functional