Skip to main content
Addgene

sgRNA BRCA2 R2896C
(Plasmid #139511)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139511 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    B52 (Addgene #100708)
  • Backbone size w/o insert (bp) 2633
  • Total vector size (bp) 2637
  • Modifications to backbone
    Insertion of the sgRNA at the BbsI cloning site. The BsmBI cloning site is still available to express a second sgRNA.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA to insert BRCA2 E2896C using base editing
  • gRNA/shRNA sequence
    AAGTTCGTGCTTTGCAAGA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    19
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA BRCA2 R2896C was a gift from Alberto Ciccia (Addgene plasmid # 139511 ; http://n2t.net/addgene:139511 ; RRID:Addgene_139511)

  • For your References section:

    Detection of Marker-Free Precision Genome Editing and Genetic Variation through the Capture of Genomic Signatures. Billon P, Nambiar TS, Hayward SB, Zafra MP, Schatoff EM, Oshima K, Dunbar A, Breinig M, Park YC, Ryu HS, Tschaharganeh DF, Levine RL, Baer R, Ferrando A, Dow LE, Ciccia A. Cell Rep. 2020 Mar 10;30(10):3280-3295.e6. doi: 10.1016/j.celrep.2020.02.068. 10.1016/j.celrep.2020.02.068 PubMed 32160537
Related items: