pCAGGS-mEGFP-loxP-P2A-dTKneo-pA-loxP
(Plasmid
#139484)
-
PurposePCR template for mEGFP gene knock-in donor vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerJunichi Miyazaki (Osaka University, Japan)
- Backbone size w/o insert (bp) 4870
- Total vector size (bp) 7777
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEGFP-loxP-P2A-dTKneo-pA-loxP
-
Alt namedTKneo: deleted thymidine kinase gene fused with neo gene for positive and negative selection
-
SpeciesSynthetic
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- mEGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catgttcatgccttcttctttttcc
- 3′ sequencing primer agatgctcaaggggcttcatgatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-mEGFP-loxP-P2A-dTKneo-pA-loxP was a gift from Kazuhiro Aoki (Addgene plasmid # 139484 ; http://n2t.net/addgene:139484 ; RRID:Addgene_139484) -
For your References section:
Single-cell quantification of the concentrations and dissociation constants of endogenous proteins. Komatsubara AT, Goto Y, Kondo Y, Matsuda M, Aoki K. J Biol Chem. 2019 Apr 12;294(15):6062-6072. doi: 10.1074/jbc.RA119.007685. Epub 2019 Feb 9. 10.1074/jbc.RA119.007685 PubMed 30739083