Skip to main content
Addgene

pCAGGS-mEGFP-loxP-P2A-dTKneo-pA-loxP
(Plasmid #139484)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139484 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    Junichi Miyazaki (Osaka University, Japan)
  • Backbone size w/o insert (bp) 4870
  • Total vector size (bp) 7777
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP-loxP-P2A-dTKneo-pA-loxP
  • Alt name
    dTKneo: deleted thymidine kinase gene fused with neo gene for positive and negative selection
  • Species
    Synthetic
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • mEGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer agatgctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-mEGFP-loxP-P2A-dTKneo-pA-loxP was a gift from Kazuhiro Aoki (Addgene plasmid # 139484 ; http://n2t.net/addgene:139484 ; RRID:Addgene_139484)
  • For your References section:

    Single-cell quantification of the concentrations and dissociation constants of endogenous proteins. Komatsubara AT, Goto Y, Kondo Y, Matsuda M, Aoki K. J Biol Chem. 2019 Apr 12;294(15):6062-6072. doi: 10.1074/jbc.RA119.007685. Epub 2019 Feb 9. 10.1074/jbc.RA119.007685 PubMed 30739083