Skip to main content
Addgene

pMT423
(Plasmid #139382)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139382 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNBU2
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Constitutively expressed dCas9, LacI and TetR
  • Promoter P1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AACGCACTGAGAAGCCCTTA
  • 3′ sequencing primer CCGGGGGATCgcggccgtagaagcaatttgattagtaatctaaaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT423 was a gift from Christopher Voigt (Addgene plasmid # 139382 ; http://n2t.net/addgene:139382 ; RRID:Addgene_139382)
  • For your References section:

    Genetic circuit design automation for the gut resident species Bacteroides thetaiotaomicron. Taketani M, Zhang J, Zhang S, Triassi AJ, Huang YJ, Griffith LG, Voigt CA. Nat Biotechnol. 2020 Aug;38(8):962-969. doi: 10.1038/s41587-020-0468-5. Epub 2020 Mar 30. 10.1038/s41587-020-0468-5 PubMed 32231334