Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMSCV-NLS-CBRed-d2-hygro
(Plasmid #139196)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139196 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMSCV-hygro
  • Backbone size w/o insert (bp) 6586
  • Total vector size (bp) 8394
  • Vector type
    Mammalian Expression, Retroviral, Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CBRed
  • Alt name
    Click beetle red luciferase
  • Species
    Synthetic; Pyrophosphorus plagiophthalamus
  • Insert Size (bp)
    1764
  • Tags / Fusion Proteins
    • nuclear localization signal (NLS) (N terminal on insert)
    • d2 PEST domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-NLS-CBRed-d2-hygro was a gift from Matthew Lazzara (Addgene plasmid # 139196 ; http://n2t.net/addgene:139196 ; RRID:Addgene_139196)
  • For your References section:

    Glioblastoma Cell Resistance to EGFR and MET Inhibition Can Be Overcome via Blockade of FGFR-SPRY2 Bypass Signaling. Day EK, Sosale NG, Xiao A, Zhong Q, Purow B, Lazzara MJ. Cell Rep. 2020 Mar 10;30(10):3383-3396.e7. doi: 10.1016/j.celrep.2020.02.014. 10.1016/j.celrep.2020.02.014 PubMed 32160544