Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSB-Bleo Gal4 CCS1
(Plasmid #139189)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139189 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSB-Bleo
  • Total vector size (bp) 5674
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Bleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    caffeine synthase 1 [Coffea arabica]
  • Alt name
    CCS1
  • Species
    Coffee arabica
  • Insert Size (bp)
    1152
  • GenBank ID
    Q8H0D3.1
  • Promoter Gal4-inducible CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer gatgagtttggacaaaccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SB-transposon with Gal4 inducible coffee caffeine synthase 1 (CCS1) [Coffea arabica]and constitutive bleomycin resistance.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB-Bleo Gal4 CCS1 was a gift from Neal Devaraj (Addgene plasmid # 139189 ; http://n2t.net/addgene:139189 ; RRID:Addgene_139189)