pSBTet(-ΔrtTA)-GB dTomato-P2A-CaMXMT
(Plasmid #139176)

• Purpose: SB-transposon with inducible expression of dTomato and Coffea arabica monomethylxathine methyltransferase via P2A self-cleaving linker in a Tet-inducible pSBTRE(-ΔrtTA)-GB backbone.
• Depositing Lab: Neal Devaraj
• Publication: Methylxanthine Synthesis in Human Cells (unpublished)

Backbone

• Vector backbone: pSBTet-GB
• Total vector size (bp): 7575
• Modifications to backbone: -ΔrtTA
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CaMXMT
• Species: Coffea arabica
• Insert Size (bp): 1902
• Mutation: P131T on dTomato (Please see depositor comments)
• GenBank ID: XP_027086104
• Promoter: tight TRE-controlled CMV
• Tag / Fusion Protein:
  • dTomato-P2A (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTCCTACCCTCGAAAGGC
• 3′ sequencing primer: GTGGTTTGTCCAAACTCATC

Resource Information

• Supplemental Documents:
  • pSBTRE-GB dTomato-P2A-CaMXMT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SB-transposon with inducible SfiI cloning site containing dTomato-P2A-CaMXMT and constitutive expression of GFP and blasticidin resistance gene. Inducible gene expression can be stimulated by co-expression of TetOFF (e.g. tTA-advanced, TetRVP64).
Found mutation P131T on dTomato, depositor confirms this is not a concern