pSBBi-RP CCS1(Δ304-316)
(Plasmid #139163)

• Purpose: SB-transposon with constitutive bi-directional promoter. One side contains coffee caffeine synthase 1 (CCS1) CCS-CTS deletion mutant; the other side contains RFP and puromycin resistance genes.
• Depositing Lab: Neal Devaraj
• Publication: Methylxanthine Synthesis in Human Cells (unpublished)

Backbone

• Vector backbone: pSBBi-RP
• Total vector size (bp): 7554
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: caffeine synthase 1 [Coffea arabica] CCS-CTS region deletion
• Alt name: CCS1 CCS-CTS deletion
• Alt name: CCS1(delC13)
• Alt name: CCS1(Δ304-319)
• Species: Coffee arabica
• Insert Size (bp): 1113
• Mutation: deleted amino acids 304-319
• GenBank ID: Q8H0D3.1
• Promoter: EF1α

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pSBBi-RP CCS1(d307-319).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SB-transposon with constitutive bi-directional promoter. One side contains Coffea arabica caffeine synthase 1 with CCS-CTS deletion (Δ304-316) which has been reported* to affect enzyme selectivity; the other side contains RFP and puromycin resistance genes.

*CCS-CTS deletion reference: Mizuno, K., et al. Z Naturforsch C J Biosci. Mar-Apr 2010;65(3-4):257-65. doi: 10.1515/znc-2010-3-414.