pSBBi-RP PcCS
(Plasmid
#139159)
-
PurposeSB-transposon with constitutive bi-directional promoter. One side contains Paullinia cupana caffeine synthase (PcCS); the other side contains RFP and puromycin resistance genes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 139159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSBBI-RP
- Total vector size (bp) 7524
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaffeine Synthase [Paullinia cupana var. sorbilis]
-
Alt namePcCS
-
Alt namePaullinia cupana var. sorbilis Caffeine Synthase
-
SpeciesPaullinia cupana
-
Insert Size (bp)1089
-
GenBank IDBK008796.1 DAA64605.1
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SB-transposon with constitutive bi-directional promoter. One side contains predicted Paullinia cupana ancestral Caffeine Synthase 2; the other side contains RFP and puromycin resistance genes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBBi-RP PcCS was a gift from Neal Devaraj (Addgene plasmid # 139159 ; http://n2t.net/addgene:139159 ; RRID:Addgene_139159)