pL90-Nat-2xHO
(Plasmid #139069)

• Purpose: CRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selection
• Depositing Lab: Gianni Liti
• Publication: Barre et al Genome Res. 2020 Apr 10. pii: gr.253351.119. doi: 10.1101/gr.253351.119.

Backbone

• Vector backbone: pL59-Nat
• Backbone manufacturer: Addgene plasmid # 140465, based on backbone made by Jean-Marc Daran (Addgene plasmid # 101165)
• Total vector size (bp): 10002
• Modifications to backbone: Insertion of two guide RNAs targeting the HO locus
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Plasmid yield is 1-5 ug in a miniprep
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Two guide RNAs targeting the HO endonuclease
• Insert Size (bp): 432
• Promoter: TDH3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGTAGGTATTGATTGTAATTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Experiments were performed with 2 hours recovery in YPD. Plasmid is loss performed with growth in rich medium and confirmed with loss of Nourseothricin resistance.